ID: 1167121685_1167121701

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1167121685 1167121701
Species Human (GRCh38) Human (GRCh38)
Location 19:47521109-47521131 19:47521154-47521176
Sequence CCAACAGGGGACAGGGAGGGTGG AACGCCCTGGAGAGGCCGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 461} {0: 1, 1: 0, 2: 1, 3: 4, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!