ID: 1167126035_1167126041

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1167126035 1167126041
Species Human (GRCh38) Human (GRCh38)
Location 19:47549355-47549377 19:47549370-47549392
Sequence CCCGCACAGGCTGCAGTCCAGAA GTCCAGAAGTGGGTTTTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 1086} {0: 1, 1: 0, 2: 0, 3: 11, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!