ID: 1167126093_1167126100

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1167126093 1167126100
Species Human (GRCh38) Human (GRCh38)
Location 19:47549684-47549706 19:47549726-47549748
Sequence CCACGTGTGGAGGGATGACTGCA CAGCATGACCACAATGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 100} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!