ID: 1167129170_1167129186

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1167129170 1167129186
Species Human (GRCh38) Human (GRCh38)
Location 19:47573135-47573157 19:47573175-47573197
Sequence CCCAGCGGCCTCCCGCCTTCCCC CGCGCAGCCCGGCCCACCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 387} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!