ID: 1167149842_1167149857

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1167149842 1167149857
Species Human (GRCh38) Human (GRCh38)
Location 19:47702243-47702265 19:47702295-47702317
Sequence CCATCGACAGCATCCTGAACCTG CTCGTACCCCCACGCTGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117} {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!