ID: 1167152216_1167152221

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1167152216 1167152221
Species Human (GRCh38) Human (GRCh38)
Location 19:47716837-47716859 19:47716856-47716878
Sequence CCAGTACCTGCTGGAGCAGGAGG GAGGTGCCCGGCTCCCGCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 352} {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!