ID: 1167166471_1167166478

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1167166471 1167166478
Species Human (GRCh38) Human (GRCh38)
Location 19:47802975-47802997 19:47802998-47803020
Sequence CCACACCTGGGGGGCAGAGGGGA CAGGGAGAAGGTGTGAAGGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 54, 4: 413} {0: 2, 1: 0, 2: 4, 3: 69, 4: 1009}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!