ID: 1167208099_1167208104

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1167208099 1167208104
Species Human (GRCh38) Human (GRCh38)
Location 19:48116002-48116024 19:48116020-48116042
Sequence CCAGCGACCCCCTGCTCAGTCTC GTCTCCTCCCTCCTCCACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 239} {0: 1, 1: 0, 2: 7, 3: 47, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!