|
Left Crispr |
Right Crispr |
| Crispr ID |
1167214211 |
1167214219 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:48153711-48153733
|
19:48153764-48153786
|
| Sequence |
CCTTCCTCCTCCTCCTTCCTCTT |
ACACACACACCTCTCCTTCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 77, 2: 375, 3: 1525, 4: 6445} |
{0: 2, 1: 2, 2: 8, 3: 49, 4: 364} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|