ID: 1167218977_1167218981

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1167218977 1167218981
Species Human (GRCh38) Human (GRCh38)
Location 19:48184986-48185008 19:48185022-48185044
Sequence CCCTCTGCAGGATTGTCCCTGTG TCATAGATCAGAGCCTTCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!