ID: 1167218977_1167218983

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1167218977 1167218983
Species Human (GRCh38) Human (GRCh38)
Location 19:48184986-48185008 19:48185027-48185049
Sequence CCCTCTGCAGGATTGTCCCTGTG GATCAGAGCCTTCCCTGGAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!