ID: 1167239441_1167239448

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1167239441 1167239448
Species Human (GRCh38) Human (GRCh38)
Location 19:48334347-48334369 19:48334365-48334387
Sequence CCCAGAGCTCAGTCGAGGGATCT GATCTATTTGGGGATTTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 103} {0: 1, 1: 0, 2: 3, 3: 31, 4: 529}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!