ID: 1167251098_1167251110

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1167251098 1167251110
Species Human (GRCh38) Human (GRCh38)
Location 19:48398820-48398842 19:48398860-48398882
Sequence CCGTGCACGGCGGCGCCGCGCTC GCGCGCGACCGGGGCGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 78} {0: 2, 1: 1, 2: 10, 3: 131, 4: 727}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!