ID: 1167253953_1167253960

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1167253953 1167253960
Species Human (GRCh38) Human (GRCh38)
Location 19:48415992-48416014 19:48416011-48416033
Sequence CCCACCCCAGGTGTTCTACCAGC CAGCGCGCAGACATGGCCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 406, 4: 7964} {0: 1, 1: 1, 2: 3, 3: 3, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!