ID: 1167258412_1167258424

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1167258412 1167258424
Species Human (GRCh38) Human (GRCh38)
Location 19:48444053-48444075 19:48444084-48444106
Sequence CCCCGCCTGGAGCAGCGTCCTGC GTTCTGGAGGAACCGCAAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 178} {0: 1, 1: 0, 2: 1, 3: 11, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!