ID: 1167268190_1167268206

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1167268190 1167268206
Species Human (GRCh38) Human (GRCh38)
Location 19:48493642-48493664 19:48493691-48493713
Sequence CCTGCTCCCTCCAGGCCGCGACC CACCTGGTCGAAGAGGTAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 353} {0: 1, 1: 1, 2: 0, 3: 13, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!