ID: 1167271049_1167271052

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1167271049 1167271052
Species Human (GRCh38) Human (GRCh38)
Location 19:48506505-48506527 19:48506527-48506549
Sequence CCTACTGGGGCCTGGCGGGAGGC CAGAGCCACTTGTGTGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 270} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!