ID: 1167271724_1167271734

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1167271724 1167271734
Species Human (GRCh38) Human (GRCh38)
Location 19:48509990-48510012 19:48510031-48510053
Sequence CCATGGGATGCTGGTCATGGCGT GAAGGCTGCGGGGCAGGCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 93} {0: 1, 1: 0, 2: 2, 3: 36, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!