ID: 1167286233_1167286239

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1167286233 1167286239
Species Human (GRCh38) Human (GRCh38)
Location 19:48600156-48600178 19:48600172-48600194
Sequence CCCATCTTCCCCTCCACAGCTCT CAGCTCTAGCAGCTCTAGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 525} {0: 1, 1: 0, 2: 1, 3: 8, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!