ID: 1167286995_1167287010

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1167286995 1167287010
Species Human (GRCh38) Human (GRCh38)
Location 19:48603858-48603880 19:48603910-48603932
Sequence CCAGTCAGCAGGGTCACCAGGCC AGCTGGGGGTCGGGGAGTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 202} {0: 1, 1: 0, 2: 8, 3: 64, 4: 697}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!