ID: 1167291144_1167291155

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1167291144 1167291155
Species Human (GRCh38) Human (GRCh38)
Location 19:48625868-48625890 19:48625898-48625920
Sequence CCTTCTCTCCTCCCTTCCCACAG ACCAGGAGCTGACCGGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 149, 4: 1571} {0: 1, 1: 0, 2: 0, 3: 19, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!