ID: 1167305061_1167305070

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1167305061 1167305070
Species Human (GRCh38) Human (GRCh38)
Location 19:48703436-48703458 19:48703466-48703488
Sequence CCGCCAGGAGATCCTCCAGGAGT GCACGACCACGTGCGGGAGGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 21, 4: 243} {0: 1, 1: 1, 2: 0, 3: 6, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!