ID: 1167305265_1167305270

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1167305265 1167305270
Species Human (GRCh38) Human (GRCh38)
Location 19:48704618-48704640 19:48704663-48704685
Sequence CCCAAAAGGGCTGCTACACATCC CTTTCAAAAACAGCAGAAAGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 117} {0: 2, 1: 0, 2: 2, 3: 39, 4: 667}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!