ID: 1167308417_1167308423

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1167308417 1167308423
Species Human (GRCh38) Human (GRCh38)
Location 19:48721866-48721888 19:48721883-48721905
Sequence CCTCCCGCTCTGCAGGGGGAGGG GGAGGGTCCCACGCGGCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 296} {0: 1, 1: 0, 2: 2, 3: 34, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!