ID: 1167313955_1167313960

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1167313955 1167313960
Species Human (GRCh38) Human (GRCh38)
Location 19:48753122-48753144 19:48753149-48753171
Sequence CCTGGGGGATGGAGAACCTGTTT GGCTGCCGCCGGAGCGCGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 268} {0: 1, 1: 0, 2: 2, 3: 20, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!