ID: 1167326926_1167326934 |
View in Genome Browser |
Spacer: -5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1167326926 | 1167326934 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 19:48832441-48832463 | 19:48832459-48832481 |
| Sequence | CCAAGTGAGGGCACAGCCCTGGG | CTGGGGACACACAGGAGGGATGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 3, 2: 11, 3: 68, 4: 607} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||