ID: 1167337510_1167337522

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1167337510 1167337522
Species Human (GRCh38) Human (GRCh38)
Location 19:48896062-48896084 19:48896078-48896100
Sequence CCCGTCTCCGCAATCCCGGGTTT CGGGTTTGGGGTGGGGGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47} {0: 1, 1: 0, 2: 4, 3: 85, 4: 685}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!