ID: 1167358911_1167358922

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1167358911 1167358922
Species Human (GRCh38) Human (GRCh38)
Location 19:49019635-49019657 19:49019663-49019685
Sequence CCACCCAGACACCTGGGAAGGAC CGGTGGTGGTCTGCGAGTTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!