ID: 1167358913_1167358929

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1167358913 1167358929
Species Human (GRCh38) Human (GRCh38)
Location 19:49019639-49019661 19:49019687-49019709
Sequence CCAGACACCTGGGAAGGACCCCC GGCTGGGGCCCGAAGTATTCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 1, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!