ID: 1167358920_1167358938

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1167358920 1167358938
Species Human (GRCh38) Human (GRCh38)
Location 19:49019659-49019681 19:49019708-49019730
Sequence CCCGCGGTGGTGGTCTGCGAGTT GGGGCGCGCGGGTCCCCGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 39} {0: 1, 1: 0, 2: 1, 3: 19, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!