ID: 1167361483_1167361494

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1167361483 1167361494
Species Human (GRCh38) Human (GRCh38)
Location 19:49032702-49032724 19:49032721-49032743
Sequence CCACCTCAGGGCCAGACCCACAG ACAGAGGCAGCGGGGGAGGAAGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 2, 3: 37, 4: 363} {0: 7, 1: 2, 2: 4, 3: 119, 4: 1437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!