ID: 1167361483_1167361499

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1167361483 1167361499
Species Human (GRCh38) Human (GRCh38)
Location 19:49032702-49032724 19:49032744-49032766
Sequence CCACCTCAGGGCCAGACCCACAG GTGGTCTGCCTCTCTGGTCAGGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 2, 3: 37, 4: 363} {0: 6, 1: 0, 2: 0, 3: 12, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!