ID: 1167366399_1167366412

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1167366399 1167366412
Species Human (GRCh38) Human (GRCh38)
Location 19:49057048-49057070 19:49057093-49057115
Sequence CCCAGGGGCTCGGCGTGCACCGG GGCGGTGCCGAGCGAGAGCCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 75} {0: 2, 1: 0, 2: 1, 3: 17, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!