ID: 1167376089_1167376097

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1167376089 1167376097
Species Human (GRCh38) Human (GRCh38)
Location 19:49112898-49112920 19:49112935-49112957
Sequence CCAGTATCGGCCAGGCAAGGTGG CCCAGCACTTTGGGAGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 188, 4: 836} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!