ID: 1167377245_1167377259

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1167377245 1167377259
Species Human (GRCh38) Human (GRCh38)
Location 19:49118822-49118844 19:49118862-49118884
Sequence CCTCGTCCGCCGGGGGAACCCTG TGCGTGGGAGTCGCGGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69} {0: 1, 1: 0, 2: 0, 3: 8, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!