ID: 1167409237_1167409244

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1167409237 1167409244
Species Human (GRCh38) Human (GRCh38)
Location 19:49335286-49335308 19:49335307-49335329
Sequence CCCCTCAGGTACCAGAGCATGTG TGTCCCAGTGGAGCAGGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 153} {0: 1, 1: 0, 2: 2, 3: 29, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!