ID: 1167409477_1167409487

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1167409477 1167409487
Species Human (GRCh38) Human (GRCh38)
Location 19:49336620-49336642 19:49336663-49336685
Sequence CCAATGTCACAGAACAAGTGATA GAGGAGGAGCTGAAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 260} {0: 1, 1: 2, 2: 74, 3: 788, 4: 3401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!