ID: 1167412642_1167412648

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1167412642 1167412648
Species Human (GRCh38) Human (GRCh38)
Location 19:49354124-49354146 19:49354161-49354183
Sequence CCGTCAACACTCCTGCCTCACCG TACCCAACCAATGCCTAGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 2, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!