ID: 1167425316_1167425329

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1167425316 1167425329
Species Human (GRCh38) Human (GRCh38)
Location 19:49427181-49427203 19:49427230-49427252
Sequence CCCAGCCCCACCGAAATTTCCCA AAAATGCAACAGATGTACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 154} {0: 1, 1: 0, 2: 0, 3: 18, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!