ID: 1167427070_1167427073

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1167427070 1167427073
Species Human (GRCh38) Human (GRCh38)
Location 19:49434779-49434801 19:49434800-49434822
Sequence CCTGCAGGATCCTCACGAAGATG TGACACAGCCATAGTGGACGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 109} {0: 1, 1: 0, 2: 2, 3: 8, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!