ID: 1167430821_1167430830

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1167430821 1167430830
Species Human (GRCh38) Human (GRCh38)
Location 19:49453458-49453480 19:49453487-49453509
Sequence CCCCAGGCCTGGGCGCCCGGTTT GGGAGTCCCGTCATCCACTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 120} {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!