ID: 1167434256_1167434259

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1167434256 1167434259
Species Human (GRCh38) Human (GRCh38)
Location 19:49470031-49470053 19:49470053-49470075
Sequence CCTCCTGTTGGTAACAGATGTGA AACTTGTTGACAAGAGCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104} {0: 1, 1: 1, 2: 0, 3: 5, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!