ID: 1167446213_1167446226

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1167446213 1167446226
Species Human (GRCh38) Human (GRCh38)
Location 19:49539105-49539127 19:49539158-49539180
Sequence CCTTTCTCCTCCAGGAAACCCTG GTCCAGGTGGAGGAGTACATCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 72, 4: 483} {0: 1, 1: 0, 2: 0, 3: 15, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!