ID: 1167447794_1167447796

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1167447794 1167447796
Species Human (GRCh38) Human (GRCh38)
Location 19:49548737-49548759 19:49548785-49548807
Sequence CCACTGATCTCAGCTCACTGATC GCTTCAGCCTCCCTAGTAGCTGG
Strand - +
Off-target summary No data {0: 280, 1: 14260, 2: 204825, 3: 263475, 4: 185241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!