ID: 1167452973_1167452980

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1167452973 1167452980
Species Human (GRCh38) Human (GRCh38)
Location 19:49583270-49583292 19:49583296-49583318
Sequence CCTGGATACTTCACCCAGTGAGG CAGACCAAGGTGAGTGTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 87} {0: 1, 1: 0, 2: 0, 3: 25, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!