ID: 1167469945_1167469952

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1167469945 1167469952
Species Human (GRCh38) Human (GRCh38)
Location 19:49670134-49670156 19:49670153-49670175
Sequence CCGGGAAGCCACGCCTCCCGGCC GGCCCTCTATTGGCTGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 251} {0: 1, 1: 0, 2: 0, 3: 14, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!