ID: 1167479265_1167479270

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1167479265 1167479270
Species Human (GRCh38) Human (GRCh38)
Location 19:49719535-49719557 19:49719552-49719574
Sequence CCCTGGCCCTTCTTGGCGTTCTT GTTCTTCCTCTTCACGCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 21, 4: 173} {0: 1, 1: 0, 2: 1, 3: 5, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!