ID: 1167479265_1167479273

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1167479265 1167479273
Species Human (GRCh38) Human (GRCh38)
Location 19:49719535-49719557 19:49719557-49719579
Sequence CCCTGGCCCTTCTTGGCGTTCTT TCCTCTTCACGCGGCCGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 21, 4: 173} {0: 1, 1: 2, 2: 0, 3: 5, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!