ID: 1167479347_1167479352

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1167479347 1167479352
Species Human (GRCh38) Human (GRCh38)
Location 19:49719975-49719997 19:49720014-49720036
Sequence CCATACTCGCCGATCAGCTTCAG GATTTCTCGAAGGGTCTCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 36} {0: 2, 1: 0, 2: 1, 3: 2, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!