ID: 1167507758_1167507770

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1167507758 1167507770
Species Human (GRCh38) Human (GRCh38)
Location 19:49880146-49880168 19:49880194-49880216
Sequence CCGCACCCGGCCTGCTGTACCTT TTCAATGGGGCTATCTTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 12, 3: 173, 4: 1080} {0: 1, 1: 0, 2: 2, 3: 6, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!